-
Notifications
You must be signed in to change notification settings - Fork 11
Open
Description
Hi Sébastien,
I am not getting any results for -gene-ontology and I have followed the instructions from your 2012 paper git repo. It seems that the cds sequence part of the script was not working due to changes in the folder structure and I was manually able to add sequences.
Assuming I got the right EMBL CDS sequences. Here is the sample of one of the sequence file in EMBL_CDS_Sequences folder
$ head -n 300 000-Sequences.Part.40.fasta
>ENA|ACU04235|ACU04235.1 Pedobacter heparinus DSM 2366 glycosyl transferase family 2
atgaaaacaacttctattgtcactgtaaattttaaccagccccaggtaactattgattttc
cttaaatctgtaaaagttaacacatctgctgaaaaagtagaggtcattttggttgataatg
Here is my sample of Associations.txt
$head -n 200 Associations.txt
ABJ90153 GO:0003824
ABJ90153 GO:0003870
ABJ90153 GO:0009058
Here is my sample of Uniprot file:
$head -n 10 gene_association.goa_uniprot
!gaf-version: 2.0
!
!This file contains all GO annotations and gene product information for proteins in the UniProt KnowledgeBase (UniProtKB).
!and IntAct protein complexes.
!If a particular gene product is not annotated with GO, then it will not appear in this file.
!
!Generated: 2014-10-27 16:53
!
UniProtKB A0A000 moeA5 GO:0003824 GO_REF:0000002 IEA InterPro:IPR015421|InterPro:IPR015422 F MoeA5 A0A000_9ACTO|moeA5 protein taxon:35758 20141025 InterPro
UniProtKB A0A000 moeA5 GO:0003870 GO_REF:0000002 IEA InterPro:IPR010961 F MoeA5 A0A000_9ACTO|moeA5 protein taxon:35758 20141025 InterPro
Here is my command
mpiexec -n 4 Ray \
-s \
trimmed_seq1.fastq \
-search \
/mnt/microbiome/Build-Input-Files-for-Gene-Ontology/EMBL_CDS_Sequences \
-o \
RayMicrobiomeAnalysis_ont \
-gene-ontology \
/mnt/microbiome/Build-Input-Files-for-Gene-Ontology/OntologyTerms.txt \
/mnt/microbiome/Build-Input-Files-for-Gene-Ontology/Annotations.txt
I am not sure why I am getting empty files( Just Headers) for Terms.tsv and Terms.xml.
Metadata
Metadata
Assignees
Labels
No labels