Skip to content

Rehaul BAM and SAM accessor functions#28

Open
jakobnissen wants to merge 9 commits into
BioJulia:developfrom
jakobnissen:rehaul
Open

Rehaul BAM and SAM accessor functions#28
jakobnissen wants to merge 9 commits into
BioJulia:developfrom
jakobnissen:rehaul

Conversation

@jakobnissen
Copy link
Copy Markdown
Member

@jakobnissen jakobnissen commented Aug 7, 2020

See also #24 and #25 .

This is a work in progress. In particular, I will first change the BAM code and get that right, and then afterwards change the SAM code to behave identically. Ideally, I would like SAM and BAM records to behave almost exactly identical, but that might not be feasible, let's see.

Changes: (updated as I go along):

  • Changes to "has"-functions, e.g. hasposition to always return a Bool
  • Accessor functions now return what they're supposed to (see Various spec violations #24 )
  • There are no more unfilled BAM records, so isfilled and hasflag has been removed
  • Changed printing of records in the REPL

Things to mull over

  • Should we even have has-functions, or just return a specific sentinel value when the record doesn't have the information available, e.g. nothing? The latter may be neater.
  • Which sentinel value? I'm leaning towards nothing (because it so qucikly errors if you dont handle it correctly, that leads to fewer bugs for the end user), but if you want missing, that's fine as well.

@jakobnissen
Copy link
Copy Markdown
Member Author

jakobnissen commented Aug 7, 2020

Changed printing of records:
Before, empty record:

XAM.BAM.Record:
      template name: nothing
               flag: 4
       reference ID: nothing
           position: nothing
    mapping quality: nothing
              CIGAR: 
  next reference ID: nothing
      next position: nothing
    template length: nothing
           sequence: nothing
       base quality: nothing
     auxiliary data:

After, empty record

XAM.BAM.Record:
      template name: 
               flag: 0x0004
       reference ID: 
           position: 
    mapping quality: 
              CIGAR: 
  next reference ID: 
      next position: 
    template length: 
           sequence: 
       base quality: 
     auxiliary data:

Before, filled record:

XAM.BAM.Record:
      template name: HWI-1KL120:88:D0LRBACXX:1:1101:2205:2204
               flag: 83
       reference ID: 1
           position: 132616
    mapping quality: 60
              CIGAR: 101M
  next reference ID: 1
      next position: 132491
    template length: 226
           sequence: GGTCCCACCTTGTCCTCCTCCTACACATACTCGGATGCTTCCTCCTCAACCTTGGCACCCACCTCCTTCTTACTGGGCCCAGGAGCCTTCAATGCCCAGGA
       base quality: UInt8[0x21, 0x21, 0x21, 0x1f, 0x1e, 0x22, 0x1d, 0x1e, 0x1e, 0x1e  …  0x27, 0x25, 0x25, 0x25, 0x25, 0x25, 0x25, 0x22, 0x22, 0x22]
     auxiliary data: XT=U NM=3 SM=37 AM=37 X0=1 X1=0 XM=3 XO=0 XG=0 MD=4A4C82A8

After, filled record:

XAM.BAM.Record:
      template name: "HWI-1KL120:88:D0LRBACXX:1:1101:2205:2204"
               flag: 0x0053
       reference ID: 1
           position: 132616
    mapping quality: 0x3c
              CIGAR: "101M"
  next reference ID: 1
      next position: 132491
    template length: 226
           sequence: GGTCCCACCTTGTCCTCCTCCTACACAT…CTGGGCCCAGGAGCCTTCAATGCCCAGGA
       base quality: ▆▆▆▆▆▆▄▆▆▆▆▆▆▇▇▇▇▇▇▇▆▆▄▆▄▄▆▆…▇▇██████████████▇▇▇▇▇▇▇▇▇▇▆▆▆
     auxiliary data: XT='U' NM=0x03 SM=0x25 AM=0x25 X0=0x01 X1=0x00 XM=0x03 XO=0x00 XG=0x00 MD="4A4C82A8"

Comment thread src/common.jl
Comment on lines +1 to +27
function quality_string(quals::Vector{UInt8})
characters = Vector{Char}(undef, length(quals))
for i in eachindex(quals)
@inbounds qual = quals[i]
if qual < 10
char = ' '
elseif qual < 15
char = '▁'
elseif qual < 20
char = '▂'
elseif qual < 25
char = '▃'
elseif qual < 30
char = '▄'
elseif qual < 35
char = '▆'
elseif qual < 40
char = '▇'
elseif qual < 255
char = '█'
else
char = '?'
end
@inbounds characters[i] = char
end
return join(characters)
end
Copy link
Copy Markdown
Member

Choose a reason for hiding this comment

The reason will be displayed to describe this comment to others. Learn more.

What about factoring out the kernel?

function quality_char(qual::UInt8)
	if qual < 10
		return  ' '
	end
	if qual < 15
		return ''
	end
	if qual < 20
		return ''
	end
	if qual < 25
		return ''
	end
	if qual < 30
		return ''
	end
	if qual < 35
		return ''
	end
	if qual < 40
		return ''
	end
	if qual < 255
		return ''
	end

	return '?'
end

function quality_string(quals::Vector{UInt8})
    return String(quality_char.(quals))
end

@CiaranOMara
Copy link
Copy Markdown
Member

Should we even have has-functions, or just return a specific sentinel value when the record doesn't have the information available, e.g. nothing? The latter may be neater.

I think the has and is functions that provide an interpretation of the data/record are useful; the clear case being the flag field. However, the has functions are not necessary for checking the presence of a value in a mandatory field.

Would it be accurate to say that we're attempting to balance out the issue of consistency between SAM and BAM: whether it is useful to have consistency at the data-level or whether it is sufficient to have consistency at the print-level?
Suppose we're to have better consistency between SAM and BAM, some default null values encountered need to be translated. If these translations occur at the data-level, they can introduce a form of double-checking (#26), which I'm fine with if we're clear that we want consistency between SAM and BAM at the data-level where possible.

In any case, I generally think accessors should assume the presence of value.

Also, once the raw byte data of a record has been interpreted, I'm not wedded to the idea that the record must maintain an exact byte structure of the original.

Which sentinel value? I'm leaning towards nothing (because it so qucikly errors if you dont handle it correctly, that leads to fewer bugs for the end user), but if you want missing, that's fine as well.

I would now lean towards nothing too -- the use of missing was annoying when chaining field comparisons.

BTW, I like that base quality print out.

@jakobnissen
Copy link
Copy Markdown
Member Author

I think it's useful to think in terms of three levels:

  • The data level, i.e. how does a record struct look: Here, we are locked to the BAM and SAM specs and can't really do much.
  • The functional interface (API level) of the package. Here, I mean what a user of XAM.jl experiences when they try to do something simple, e.g. "Extract the base qualites in Phred-33 encoding". What we basically want here is to make it as easy as possible to work with, and not necessarily tie the interface too closely to the data level. I.e. the fact that a missing quality is encoded as 0xff should not really matter for the user.
  • The print level. This is the least important one and just REPL cosmetics.

The issue with the API level is that there may be a conflict between having an easy API and having a performant one. In some circumstances it may be too difficult to NOT expose some of the underlying data, even though it shouldnt be relevant at the API level.

Actually I think the best thing may be to just make a new branch and play around a bit with it. Then I'll try to use the package in some small test code and get a feel for it.

@CiaranOMara
Copy link
Copy Markdown
Member

You present the levels well.

I wonder whether we gain anything by not locking ourselves into the spec at the data-level?

To elaborate, there are the raw data files as per BAM and SAM specs, and our interpretation of the raw data which we keep in our struct. We could translate the raw data (null defaults) as they are loaded into our struct and then again if they are written to file.

If we can rule out translation at that level, then the remaining spot for translation is in the accessors and setters.

@CiaranOMara
Copy link
Copy Markdown
Member

I don't think there is anything to gain by pushing the translation to the bottom layer. It increases complexity and introduces a performance penalty in that the fields would be translated unnecessarily for records that after a primary interrogation of the flag field would be discarded. It makes sense to defer translation to if and when you require the field data. I'm not particularly bothered by the possibility of repeated translation with multiple field access, as these fields in my experience are single-use, wouldn't you agree @jakobnissen?

@jakobnissen
Copy link
Copy Markdown
Member Author

Yes, I agree. There's also something rather nice about having the layout of a BAM struct be exactly equal to its representation in a file.

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment

Labels

None yet

Projects

None yet

Development

Successfully merging this pull request may close these issues.

2 participants