feat: add fork-safe PR validation workflow

.github/workflows/validate-pr.yml

@@ -0,0 +1,56 @@
+name: "validate-pr"
+
+on:
+  pull_request:
+
+permissions:
+  contents: "read"
+
+concurrency:
+  group: "validate-pr-${{ github.event.pull_request.number || github.run_id }}"
+  cancel-in-progress: true
+
+defaults:
+  run:
+    shell: "bash -euxo pipefail {0}"
+
+env:
+  PYTHONUNBUFFERED: "1"
+
+jobs:
+  validate:
+    runs-on: "ubuntu-24.04"
+
+    steps:
+      - name: "Checkout PR code"
+        uses: "actions/checkout@11bd71901bbe5b1630ceea73d27597364c9af683" # v4.2.2
+        with:
+          repository: "${{ github.event.pull_request.head.repo.full_name }}"
+          ref: "${{ github.event.pull_request.head.ref }}"
+          fetch-depth: 0
+          fetch-tags: true
+
+      - name: "Install system dependencies"
+        run: "sudo apt-get install genometools python3 --yes -qq >/dev/null"
+
+      - name: "Install Python dependencies"
+        run: "pip3 install -r requirements.txt"
+
+      - name: "Validate GFF files"
+        run: "./scripts/validate-gff 'data/'"
+
+      - name: "Rebuild (validation only)"
+        id: "rebuild"
+        continue-on-error: true
+        run: "./scripts/rebuild --input-dir 'data/' --output-dir 'data_output/' --no-pull --allow-dirty"
+
+      - name: "Upload validation artifacts"
+        if: "always()"
+        uses: "actions/upload-artifact@ea165f8d65b6e75b540449e92b4886f43607fa02" # v4.6.2
+        with:
+          name: "validation-output"
+          path: "data_output/"
+
+      - name: "Fail if rebuild or validation found errors"
+        if: "steps.rebuild.outcome == 'failure'"
+        run: "exit 1"

data_output/community/isuvdl/mazeller/prrsv1/orf5/yimim2025/unreleased/CHANGELOG.md

@@ -0,0 +1,22 @@
+## Unreleased
+
+- Remove invalid `qc.missingData.scoreWeight` and `qc.mixedSites.scoreWeight`
+
+## 2025-09-09T12:13:13Z
+
+Add schema definition url to `pathogen.json`. This is a purely technical change, for convenience of dataset authors. The data itself is not modified.
+
+## 2025-03-26T14:04:54Z
+
+ - Clarified dataset name as PRRSV-1 ORF5
+ - Removed 'X' marking Lelystad as a vaccine
+
+
+## 2025-03-26T11:47:13Z
+
+Fix GFF3 format issues in genome annotation
+
+
+## 2025-03-12T21:00:00Z
+
+Initial release.

data_output/community/isuvdl/mazeller/prrsv1/orf5/yimim2025/unreleased/README.md

@@ -0,0 +1,30 @@
+# Betaarterivirus europensis 1 (PRRSV-1) based on reference M96262.2 (Lelystad)
+
+
+## Dataset attributes
+
+| attribute            | value                                    |
+| -------------------- | ---------------------------------------- |
+| name                 | PRRSV-1 ORF5 Lineages, Yim-im & Zhang 2025 Vet Microbiol  |
+| refName              | LEYPOLYENV                               |
+| refAccession         | M96262.2                                 |
+| refProtein		       | AAA46278.1                               |
+
+
+## Scope of this dataset
+
+This dataset is based on [Yim-im et al., 2025](https://doi.org/10.1016/j.vetmic.2025.110413) for defining PRRSV-1 lineages on a global scale. This 
+nomeclature builds upon the following past publications:
+1. [Shi et al., 2010](https://doi.org/10.1016/j.virusres.2010.08.014)
+2. [Balka et al., 2018](https://doi.org/10.1038/s41598-018-26036-w)
+3. [Lee et al., 2023](https://doi.org/10.3390/pathogens12060757)
+
+## Authors and contacts
+
+Maintainer: [Michael Zeller](mailto:mazeller@iastate.edu?subject=[Nextclade]%20PRRSV1)
+
+For questions regarding the dataset, please contact the corresponding author of [Yim-im et al., 2025](https://doi.org/10.1016/j.vetmic.2025.110413).
+
+## What is Nextclade dataset
+
+Read more about Nextclade datasets in Nextclade documentation: https://docs.nextstrain.org/projects/nextclade/en/stable/user/datasets.html

data_output/community/isuvdl/mazeller/prrsv1/orf5/yimim2025/unreleased/lelystad_orf5.fasta

@@ -0,0 +1,2 @@
+>lelystad_orf5
+ATGAGATGTTCTCACAAATTGGGGCGTTTCTTGACTCCGCACTCTTGCTTCTGGTGGCTTTTTTTGCTGTGTACCGGCTTGTCCTGGTCCTTTGCCGATGGCAACGGCGACAGCTCGACATACCAATACATATATAACTTGACGATATGCGAGCTGAATGGGACCGACTGGTTGTCCAGCCATTTTGGTTGGGCAGTCGAGACCTTTGTGCTTTACCCGGTTGCCACTCATATCCTCTCACTGGGTTTTCTCACAACAAGCCATTTTTTTGACGCGCTCGGTCTCGGCGCTGTATCCACTGCAGGATTTGTTGGCGGGCGGTACGTACTCTGCAGCGTCTACGGCGCTTGTGCTTTCGCAGCGTTCGTATGTTTTGTCATCCGTGCTGCTAAAAATTGCATGGCCTGCCGCTATGCCCGTACCCGGTTTACCAACTTCATTGTGGACGACCGGGGGAGAGTTCATCGATGGAAGTCTCCAATAGTGGTAGAAAAATTGGGCAAAGCCGAAGTCGATGGCAACCTCGTCACCATCAAACATGTCGTCCTCGAAGGGGTTAAAGCTCAACCCTTGACGAGGACTTCGGCTGAGCAATGGGAGGCCTAG

data_output/community/isuvdl/mazeller/prrsv1/orf5/yimim2025/unreleased/lelystad_orf5.gff

@@ -0,0 +1,4 @@
+##gff-version 3
+##sequence-region	lelystad_orf5	1	606
+lelystad_orf5	Geneious	extracted region	1	606	.	+	.	Name=Extracted region from LEYPOLYENV
+lelystad_orf5	Geneious	gene	1	606	.	+	0	Name=ORF5 CDS

data_output/community/isuvdl/mazeller/prrsv1/orf5/yimim2025/unreleased/pathogen.json

@@ -0,0 +1,54 @@
+{
+  "$schema": "https://raw.githubusercontent.com/nextstrain/nextclade/refs/heads/release/packages/nextclade-schemas/input-pathogen-json.schema.json",
+  "schemaVersion": "3.0.0",
+  "files": {
+    "reference": "lelystad_orf5.fasta",
+    "pathogenJson": "pathogen.json",
+    "genomeAnnotation": "lelystad_orf5.gff",
+    "examples": "sequences.fasta",
+    "readme": "README.md",
+    "changelog": "CHANGELOG.md",
+    "treeJson": "tree.json"
+  },
+  "alignmentParams": {
+    "penaltyGapOpen": 8,
+    "penaltyGapOpenInFrame": 12,
+    "penaltyGapOpenOutOfFrame": 14,
+    "gapAlignmentSide": "left",
+    "minSeedCover": 0.01,
+    "minLength": 400
+  },
+  "attributes": {
+    "name": "PRRSV-1 ORF5",
+    "reference name": "Porcine reproductive and respiratory syndrome virus 1, ORF5 cds",
+    "reference accession": "M96262.2"
+  },
+  "qc": {
+    "missingData": {
+      "enabled": true,
+      "missingDataThreshold": 2000,
+      "scoreBias": 500
+    },
+    "snpClusters": {
+      "enabled": true,
+      "windowSize": 100,
+      "clusterCutOff": 6,
+      "scoreWeight": 50
+    },
+    "mixedSites": {
+      "enabled": true,
+      "mixedSitesThreshold": 15
+    },
+    "frameShifts": {
+      "enabled": true,
+      "scoreWeight": 20
+    },
+    "stopCodons": {
+      "enabled": true,
+      "scoreWeight": 50
+    }
+  },
+  "version": {
+    "tag": "unreleased"
+  }
+}